View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5738_low_19 (Length: 265)
Name: NF5738_low_19
Description: NF5738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5738_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 18 - 185
Target Start/End: Complemental strand, 30817193 - 30817023
Alignment:
| Q |
18 |
gtttgcaagtggcaaagctacatatcaatctcaattctcaagttgcaagggaagtcatgtgtttcattaaattttcttttttacgcagaacac---nnnn |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30817193 |
gtttgcaagtggcaaagctacatatcaatctcaattctcaagttgcaagggaagtcatgtgtttcattaaattttcttttttacgcagaacacttttttt |
30817094 |
T |
 |
| Q |
115 |
nnnnnnatgcagtcattaaagatatttatacacacagtattatttaattaatatatatagctagcaaagac |
185 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30817093 |
ttttttatgcagccattaaagatatttatacacacagtatcatttaattaatatatatagctagcaaagac |
30817023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 58
Target Start/End: Complemental strand, 30805418 - 30805378
Alignment:
| Q |
18 |
gtttgcaagtggcaaagctacatatcaatctcaattctcaa |
58 |
Q |
| |
|
||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
30805418 |
gtttgcaagtggcaaggttgcatatcaatctcaattctcaa |
30805378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University