View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5738_low_21 (Length: 263)
Name: NF5738_low_21
Description: NF5738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5738_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 28 - 246
Target Start/End: Complemental strand, 43712902 - 43712684
Alignment:
| Q |
28 |
gaaaatgtaccattttatcatgaatgatgaaagccagatgaaagggaaaatttgatgcaacagcaggttataatttgctcaggtagcattgctgtagtgg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43712902 |
gaaaatgtaccattttatcatgaatgatgaaagccaagggaaagggaaaatttgatgcaacagcaggttataatttgcttaggtagcattgctgtagtgg |
43712803 |
T |
 |
| Q |
128 |
ggtcgaatcctaaaatgccatcacatcagtgttggacgatcttagtagtaatagtagtacccttaccctaggaagagactttttgtttatgcatcaatta |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43712802 |
ggtcgaatcctaaaatgccatcacatcagtgtgggacgatcttagtagtaatagtagtacccttaccctaggaagagactttttgtttatgcatcaattg |
43712703 |
T |
 |
| Q |
228 |
ctactagttaaatacaaat |
246 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
43712702 |
ctactagttaaatacaaat |
43712684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University