View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5738_low_24 (Length: 209)
Name: NF5738_low_24
Description: NF5738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5738_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 18 - 142
Target Start/End: Complemental strand, 35454842 - 35454713
Alignment:
| Q |
18 |
gaatccatgcttgtaaatttctttatactttctcatattgaatgcaactctaatataacgtgacatgctcaaatgaca-agacatttcttaact----tg |
112 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||| || |
|
|
| T |
35454842 |
gaatccatgattgtaaatttctttatactttctcatattgaatgcaactctaatataacatgacgtgctcaaatgacagagacatttcttaacttgtatg |
35454743 |
T |
 |
| Q |
113 |
tattattgccagaattcaaaatacatattt |
142 |
Q |
| |
|
||||||||||| |||||||||||||||||| |
|
|
| T |
35454742 |
tattattgccaaaattcaaaatacatattt |
35454713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University