View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5738_low_24 (Length: 209)

Name: NF5738_low_24
Description: NF5738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5738_low_24
NF5738_low_24
[»] chr7 (1 HSPs)
chr7 (18-142)||(35454713-35454842)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 18 - 142
Target Start/End: Complemental strand, 35454842 - 35454713
Alignment:
18 gaatccatgcttgtaaatttctttatactttctcatattgaatgcaactctaatataacgtgacatgctcaaatgaca-agacatttcttaact----tg 112  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||    ||    
35454842 gaatccatgattgtaaatttctttatactttctcatattgaatgcaactctaatataacatgacgtgctcaaatgacagagacatttcttaacttgtatg 35454743  T
113 tattattgccagaattcaaaatacatattt 142  Q
    ||||||||||| ||||||||||||||||||    
35454742 tattattgccaaaattcaaaatacatattt 35454713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University