View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5739-Insertion-2 (Length: 370)
Name: NF5739-Insertion-2
Description: NF5739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5739-Insertion-2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 9 - 369
Target Start/End: Original strand, 56457235 - 56457595
Alignment:
| Q |
9 |
ataacaccaactgttctggtggattctgaatcatattcctttgcaactctaagggatcgtgatgatgaaatttctggtgcctgagcggcaggaacaacta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56457235 |
ataacaccaactgttctggtggattctgaatcatattcctttgcaactctaagggctcgtgatgatgaaatttctggtgcctgagcggcaggaacaacta |
56457334 |
T |
 |
| Q |
109 |
cgagcaaaatagcgtcattgtgctcaagatattcagagatgattttgtcattgacaatacgctggtccagtccaggcaaatcaatcaagttgaagggagg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56457335 |
cgagcaaaatagcgtcattgtgctcaagatattcagagatgattttgtcattgacaatacgctggtccagtccaggcaaatcaatcaagttgaagggagg |
56457434 |
T |
 |
| Q |
209 |
tgaagtagaagtacgaagtttgagatagatagggtcaggtttcttagtgtcggatgaaactttgctgagtctatcctgaagagaatgaagaagtgaagaa |
308 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56457435 |
tgcagtagaagtacgaagtttgagatagatagggtcaggtctcttagtgccggaagaaactttgctgagtctatcctgaagagaatgaagaagtgaagaa |
56457534 |
T |
 |
| Q |
309 |
gcagaaacttgttgggatttattattgatatgaaggaagatagaatttgaggttaaagatg |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56457535 |
gcagaaacttgttgggatttattattgatatgaaggaagatagaatttgaggttaaagatg |
56457595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University