View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5739-Insertion-4 (Length: 136)
Name: NF5739-Insertion-4
Description: NF5739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5739-Insertion-4 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 1e-63; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 10 - 136
Target Start/End: Complemental strand, 2618877 - 2618751
Alignment:
| Q |
10 |
tttttgcaggaaccaccaagtaatttgtccccattcttgcaaacaaagtcacacacttcacttagagttgggccaacacatgaactagcgaagaaagaac |
109 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2618877 |
tttttgcaggaaccacctagtaatttgtccccattcttgcaaacaaagtcacacacttcacttagagttgggccaacacatgaactagcgaagaaagaac |
2618778 |
T |
|
| Q |
110 |
tctttttctcacaaccttcaatctgca |
136 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2618777 |
tctttttctcacaaccttcaatctgca |
2618751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 39 - 136
Target Start/End: Complemental strand, 2630557 - 2630460
Alignment:
| Q |
39 |
cccattcttgcaaacaaagtcacacacttcacttagagttgggccaacacatgaactagcgaagaaagaactctttttctcacaaccttcaatctgca |
136 |
Q |
| |
|
||||| |||||||| ||||||||| || |||||| |||||||||| |||| || | ||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
2630557 |
cccatgcttgcaaataaagtcacaattttggcttagaattgggccaacgcatggaccaacgaagtcaggactctttttctcacaaccttcaatttgca |
2630460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 106 - 133
Target Start/End: Complemental strand, 2624215 - 2624188
Alignment:
| Q |
106 |
gaactctttttctcacaaccttcaatct |
133 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2624215 |
gaactctttttctcacaaccttcaatct |
2624188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University