View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5739-Insertion-5 (Length: 116)
Name: NF5739-Insertion-5
Description: NF5739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5739-Insertion-5 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 3e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 3e-42
Query Start/End: Original strand, 9 - 116
Target Start/End: Original strand, 8756050 - 8756157
Alignment:
| Q |
9 |
cattgatcgtagaggcgttcgcgttcttgtttctcgcgggaaccagttggggctccaggtgtgggttcgggtccggannnnnnnactgtgattttggaac |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8756050 |
cattgatcgtagaggcgttcgcgttcttgtttctcgcgggaaccagttggggctccaggtgtgggttcgggtccggatttttttactgtgattttggaac |
8756149 |
T |
|
| Q |
109 |
gttttagg |
116 |
Q |
| |
|
|||||||| |
|
|
| T |
8756150 |
gttttagg |
8756157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 4e-23
Query Start/End: Original strand, 9 - 116
Target Start/End: Complemental strand, 10506486 - 10506379
Alignment:
| Q |
9 |
cattgatcgtagaggcgttcgcgttcttgtttctcgcgggaaccagttggggctccaggtgtgggttcgggtccggannnnnnnactgtgattttggaac |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||| |||| ||||| || ||||||||||||| |
|
|
| T |
10506486 |
cattgttcgtagaggcgttcgcgttcttgtttctcacgggatccagttggggcaccaggtgtgggctcggctccggtttttttgacagtgattttggaac |
10506387 |
T |
|
| Q |
109 |
gttttagg |
116 |
Q |
| |
|
|||||||| |
|
|
| T |
10506386 |
gttttagg |
10506379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University