View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5740_low_15 (Length: 344)
Name: NF5740_low_15
Description: NF5740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5740_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 67 - 329
Target Start/End: Complemental strand, 36514783 - 36514521
Alignment:
| Q |
67 |
ggtagttttccataaagtatataaattcaattattgtcgtcgatgggattcgaacaacagaccttaagctagaaactctgaataaatataatattaaaga |
166 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36514783 |
ggtagttttccataaaatatataaattcaattattatcgtcggtgggattcgaacaacagaccttaagctagaaactctgaataaatataatattaaaga |
36514684 |
T |
 |
| Q |
167 |
tgctctaaatgaatgacacctaagcaatttgtattgagaatgcacgaaagagctccgtgggaatctcgtaatatactagtaattttnnnnnnnttgaaac |
266 |
Q |
| |
|
|||||||| ||||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36514683 |
tgctctaattgaatgacacctaggcaatttctactgagaatgcacgaaagagctccgtgggaatctcgtaatatactagtaatttaaaaaaaattgaaac |
36514584 |
T |
 |
| Q |
267 |
tgtatatttttggccctttggataaccgttggatacatctaatctctatcggctagggagaga |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36514583 |
tgtatatttttggccctttggataaccgttggatacatctaatctctatcggctagagagaga |
36514521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University