View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5740_low_17 (Length: 326)
Name: NF5740_low_17
Description: NF5740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5740_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 9 - 140
Target Start/End: Complemental strand, 49158853 - 49158722
Alignment:
| Q |
9 |
gtttcaccgcttaacgaaatttagggttcttaatttttactctgtgatttatgcatgttgagnnnnnnngagtgcattaccttagatggtgatgaatata |
108 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49158853 |
gtttcacagcttaacgaaatttagggttcttaatttttactctgtaatttatgcatgttgagtttttttgagtgcattaccttagatggtgatgaatata |
49158754 |
T |
|
| Q |
109 |
atatattttggttcatgaatgaaatgctaccg |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
49158753 |
atatattttggttcatgaatgaaatgctaccg |
49158722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 265 - 317
Target Start/End: Complemental strand, 49158596 - 49158544
Alignment:
| Q |
265 |
gtctggagtttgaagaatgtgtgttggtgtgttgacccttttgatgatgatgt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49158596 |
gtctggagtttgaagaatgtgtgttggtgtgttgacccttttgatgatgatgt |
49158544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University