View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5740_low_27 (Length: 228)

Name: NF5740_low_27
Description: NF5740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5740_low_27
NF5740_low_27
[»] chr4 (2 HSPs)
chr4 (100-228)||(5980174-5980302)
chr4 (1-29)||(5980075-5980103)


Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 100 - 228
Target Start/End: Original strand, 5980174 - 5980302
Alignment:
100 catccatatctcaaagcacaaagaagatcataaaaatgtgtgaatatacaatttaagtggcgattttgataagactgactataagcattacaagttgaat 199  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5980174 catccatatctcaaagcacaaagaagatcataaaaatgtgtgattatacaatttaagtggcgattttgataagactgactataagcattacaagttgaat 5980273  T
200 taaactgtaattgatttttcttatcctca 228  Q
    |||| ||||||||||||||||||||||||    
5980274 taaattgtaattgatttttcttatcctca 5980302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 5980075 - 5980103
Alignment:
1 aaaggtacttcaactatttcaataaaaac 29  Q
    |||||||||||||||||||||||||||||    
5980075 aaaggtacttcaactatttcaataaaaac 5980103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University