View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5740_low_8 (Length: 446)
Name: NF5740_low_8
Description: NF5740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5740_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 6e-75; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 121 - 275
Target Start/End: Original strand, 33225008 - 33225162
Alignment:
| Q |
121 |
atattttcatgacaccagctaactgtctgccaacttctttcatgtaacatgagacatctaaagtgtgaaactaaagaaagtcttcactactaactattta |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
33225008 |
atattttcatgacaccagctaactgtctgccaacttctttcatgtaacatgagacatctaaagtgtgaaattaaataaagtcttcactactaactattta |
33225107 |
T |
|
| Q |
221 |
caatatatttttgaatgtgtgataaaatattcttagtatttcgtctatctttatc |
275 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33225108 |
caatatattttggaatgtgtgataaaatattcttagtatttcgtctatctttatc |
33225162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 13 - 124
Target Start/End: Original strand, 33224717 - 33224827
Alignment:
| Q |
13 |
aatattatatttcttccacttacatcttatgctgttcaaaaagtcctcttctctctccccttccaaactcacaaacaaaatcttaaagtttgttcaacac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||||||| |||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33224717 |
aatattatatttcttccacttacatcttctgccgttcaaaaagtcctctcctctttcccct-ccaaactcacaaacaaaatcttaaagtttgttcaacac |
33224815 |
T |
|
| Q |
113 |
tttcatctatat |
124 |
Q |
| |
|
|||||||||||| |
|
|
| T |
33224816 |
tttcatctatat |
33224827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 370 - 430
Target Start/End: Original strand, 33225153 - 33225213
Alignment:
| Q |
370 |
tatctttatcatttattattttaagaaatatgattatttatgaggcatcaagtgtattctg |
430 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33225153 |
tatctttatcatttattattttaagaaatatgattatttatgaggtatcaagtgtattctg |
33225213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University