View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5742_high_21 (Length: 312)
Name: NF5742_high_21
Description: NF5742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5742_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 9 - 304
Target Start/End: Original strand, 46441770 - 46442065
Alignment:
| Q |
9 |
agcataggcgagctttggggagttttgcttgggcttcagatggtgattgatcgaggattcaaggcggtggagactggagttgtgtattgattcccaagca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46441770 |
agcataggcgagctttggggagttttgcttgggcttcagatggtgattgatcgaggattcaaggcggtggagactggagttgtgtattgattcccaagca |
46441869 |
T |
 |
| Q |
109 |
gttatcatgattcatgagtattaagaaagggtgtgttagtgccaatggttggagaccagtgcagaaaattcggcaactaatggagcgtgagcgggaaata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46441870 |
gttatcatgattcatgagtattaagaaagggtgtgttagtgccaatggttggagaccagtgcagaaaattcggcaactaatggagcgtgagcgggaaata |
46441969 |
T |
 |
| Q |
209 |
acgataagtcattcttatcgggaagcgaacatgtgtgcagatggacttgctaatattggatgtcgtagtagcacaaatttaatagtttatgatgat |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46441970 |
acgataagtcattcttatcgggaagcgaacatgtgtgcagatggacttgctaatattggatgtcgtagtagcacaaatttaatagtttatgatgat |
46442065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University