View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5742_high_35 (Length: 237)

Name: NF5742_high_35
Description: NF5742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5742_high_35
NF5742_high_35
[»] chr5 (2 HSPs)
chr5 (138-230)||(21580625-21580717)
chr5 (1-34)||(21580476-21580509)


Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 138 - 230
Target Start/End: Original strand, 21580625 - 21580717
Alignment:
138 gggttgtaattgtaaatgaactgtgatgggttgaattgttttccataatgcacctcttgagaggtgatgtcttgctgctgtctttgatgatgt 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||    
21580625 gggttgtaattgtaaatgaactgtgatgggttgaattgttttccataatacacctcttgagaggtgatgtcttgctgctgtctttggtgatgt 21580717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 21580476 - 21580509
Alignment:
1 tttttaaataagctaaaataagcttacgtgttgg 34  Q
    ||||||||||||||||||||||||||||||||||    
21580476 tttttaaataagctaaaataagcttacgtgttgg 21580509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University