View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5742_high_36 (Length: 236)
Name: NF5742_high_36
Description: NF5742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5742_high_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 9 - 224
Target Start/End: Complemental strand, 35867988 - 35867773
Alignment:
| Q |
9 |
catcatcaccttcttgacaatgattttgttctaatcccatgttattgtcaatatcatgtcccaagtccagtacatgctcatgggtttgtcccaagtccag |
108 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35867988 |
catcatcaccttcttgagcatgattttgttctaatcccatgttattgtcaatatcatgtcccaagtccagtacatgctcatgggtttgtcccaagtccag |
35867889 |
T |
|
| Q |
109 |
ttcatgttcatgggttggtcccaagtccagttcatgctcatgcgtttgtcccaattgatgctcgtgggctgatcccatttcaatttcatggttctcaccg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35867888 |
ttcatgttcatgggttggtcccaagtccagttcatgctcatgagtttgtcccaattgatgctcgtgggctgatcccatttcaatttcatggttctcaccg |
35867789 |
T |
|
| Q |
209 |
aggcctagatcatgat |
224 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
35867788 |
agacctagatcatgat |
35867773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University