View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5742_low_30 (Length: 290)
Name: NF5742_low_30
Description: NF5742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5742_low_30 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 109 - 290
Target Start/End: Original strand, 49202266 - 49202447
Alignment:
| Q |
109 |
agtatgattcaagtaacacaagttactggcttatgtttattttttggatgtactagttacgatgcaagctcaacgcacggcaccgcctgatatgcattgc |
208 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49202266 |
agtatgattcaagtaacacaagttattggcttatgtttattttttggatgtactagttacgatgcaagctcaacgcacggcaccccctgatatgcattgc |
49202365 |
T |
 |
| Q |
209 |
aaagacaagtttcttattataagcactgttgtcccctttggaactacagaagatgatattacatctgatatggtgagatcat |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49202366 |
aaagacaagtttcttattataagcactgttgtcccctttggaactacagaagatgacattacatctgatatggtgagatcat |
49202447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 49202160 - 49202231
Alignment:
| Q |
1 |
ccaaaggataaatgtgatttcactggtannnnnnncatttaccttcttgtttaaggctcaattcatttcata |
72 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49202160 |
ccaaaggataaatgtgatttcactggtatttttttcatttaccttcttgtttaaggctcaattcatttcata |
49202231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University