View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5742_low_33 (Length: 252)
Name: NF5742_low_33
Description: NF5742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5742_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 14 - 243
Target Start/End: Original strand, 40736051 - 40736282
Alignment:
| Q |
14 |
tcattagctacgggccggttacaccgaagtagaactcagttataaaagggttacaaaaaatgtactcaaggaaaacttcagacatatagcttagggcgtg |
113 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40736051 |
tcattagttacgggccggttacaccgaagtagaactcagttataaaagggttacaaaaaatgtactcaaggaaaacttcagacatatagcttagggcgtg |
40736150 |
T |
 |
| Q |
114 |
t--atacctgcgaggatttgcaaggttacatcagaaaaaataatatagaggtaccgaattgaaagaaaaaatgggcatgtcggagaaggatgtgcttgta |
211 |
Q |
| |
|
| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40736151 |
tgtatacctgcgaggacttgcaaggttacatcagaaaaaataatatagaggtaccgaattgaaagaaaaaatgggcatgtcggagaaggatgtgcttgta |
40736250 |
T |
 |
| Q |
212 |
tttgctgttattcctatcgtatagttgatgat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40736251 |
tttgctgttattcctatcgtatagttgatgat |
40736282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University