View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5742_low_36 (Length: 238)
Name: NF5742_low_36
Description: NF5742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5742_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 5 - 231
Target Start/End: Original strand, 39076217 - 39076443
Alignment:
| Q |
5 |
tttgcatttatgaaaaagtaaaacaagtgcaggttgaacaaaaagctttttcgattgcacgaacaaatatgaatttgtcttaacaagctaaatgcatgga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076217 |
tttgcatttatgaaaaagtaaaacaagtgcaggttgaacaaaaagctttttcgattgcacgaacaaatatgaatttgtcttaacaagctaaatgcatgga |
39076316 |
T |
|
| Q |
105 |
cattaattgcttaactatataagtcttcattcagtgttttcttcgcataattgttgagctgcatatacttagtcaattaaatacaaattagtgcaagtaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39076317 |
cattaattgcttaactatataagtcttcattcagtgttttcttcgcataattgttgagctgcatatacttagtcaattaaaaacaaattagtgcaagtaa |
39076416 |
T |
|
| Q |
205 |
atgtttagacaatgcaatgatgatgtc |
231 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
39076417 |
atgtttagacaatgcaatgatgatgtc |
39076443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University