View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5742_low_37 (Length: 238)
Name: NF5742_low_37
Description: NF5742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5742_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 868418 - 868283
Alignment:
| Q |
1 |
gtgacacaaaatatcaattgtgggagtcgtttgttgcaactccatttgtgtgcgacatgctattgttccatattctagttgttgatcaaggtcgtatatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
868418 |
gtgacacaaaatatcaattgtgggagtcgtt-gttgcaactccatttgtgtgcgacatgctattgttccatattctagttgttgatcaaggtcgtatatg |
868320 |
T |
 |
| Q |
101 |
caacgagctagcttcccccgaatatattgatgcatgc |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
868319 |
caacgagctagcttcccccgaatatattgatgcatgc |
868283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 197 - 235
Target Start/End: Complemental strand, 868248 - 868210
Alignment:
| Q |
197 |
ttggtggatcagatgaaacatgtaggtgatgatgtccat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
868248 |
ttggtggatcagatgaaacatgtaggtgatggtgtccat |
868210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University