View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5742_low_40 (Length: 237)
Name: NF5742_low_40
Description: NF5742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5742_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 138 - 230
Target Start/End: Original strand, 21580625 - 21580717
Alignment:
| Q |
138 |
gggttgtaattgtaaatgaactgtgatgggttgaattgttttccataatgcacctcttgagaggtgatgtcttgctgctgtctttgatgatgt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21580625 |
gggttgtaattgtaaatgaactgtgatgggttgaattgttttccataatacacctcttgagaggtgatgtcttgctgctgtctttggtgatgt |
21580717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 21580476 - 21580509
Alignment:
| Q |
1 |
tttttaaataagctaaaataagcttacgtgttgg |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21580476 |
tttttaaataagctaaaataagcttacgtgttgg |
21580509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University