View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5743-Insertion-3 (Length: 373)
Name: NF5743-Insertion-3
Description: NF5743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5743-Insertion-3 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 347; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 8 - 373
Target Start/End: Original strand, 1113888 - 1114254
Alignment:
| Q |
8 |
taacattcattcacaatctccaaattctgagaccatgcggtaacccattcattgttatgtgatagaaatttcaatgttgaatcatgttgaagaagtttga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1113888 |
taacattcattcacaatctccaaattctgagaccatgcggtaacccattcattgttatgtgatagaaatttcaatgttgaatcattttgaagaagtttga |
1113987 |
T |
 |
| Q |
108 |
actgtgaacattctgtggaattgtgcacacaatcccc-caaacaaactgaaactcagtaagtaaatcattcattcatcagtatttcattaccaatgtatc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1113988 |
actgtgaacattctgtggaattgtgcacacaatccccccaaacaaactgaaactcagtaagtaaatcattcattcatcattatttcattaccaatgtatc |
1114087 |
T |
 |
| Q |
207 |
attttctcattgctagattcactcatactcatagaacccttcacagacacaatactttttctcttttctctgttgtttgcaacacagatcaacataaagg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1114088 |
attttctcattgctagattcactcatactcatagaacccttcacagacacaatactttttctcttttctctgttgtttgcaacacagatcaacataaagg |
1114187 |
T |
 |
| Q |
307 |
tggcacctttacattgttaagtctcataaactcatgtgggttgtcccctgaaaaagcccttaaactt |
373 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1114188 |
tgacacctttacattgttaagtctcataaactcatgtgggttgtcccctgaaaaagcccttaaactt |
1114254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 372
Target Start/End: Complemental strand, 17377622 - 17377549
Alignment:
| Q |
299 |
cataaaggtggcacctttacattgttaagtctcataaactcatgtgggttgtcccctgaaaaagcccttaaact |
372 |
Q |
| |
|
|||||||||| |||||||||| ||| || || | || ||||||| |||||||||||||| |||||||||||| |
|
|
| T |
17377622 |
cataaaggtgacacctttacagtgtcaaaccttgttaattcatgtgagttgtcccctgaaacagcccttaaact |
17377549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University