View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5743_low_8 (Length: 252)
Name: NF5743_low_8
Description: NF5743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5743_low_8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 46303404 - 46303163
Alignment:
| Q |
11 |
cagagatacaacagtaagagcatgactggcgttatcacagaaaactccacgccatgagcaaaagtcatcattgtgtacatcatcccagtcaaggagaacg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46303404 |
cagagatacaacagtaagagcatgactggcgttatcacagaaaactccacgccatgagcaaaagtcatcattgtgtacatcatcccagtcaaggagaacg |
46303305 |
T |
 |
| Q |
111 |
tcagctatgttgttgaaggaagacttcattgccattaatgcttgtcctaatgcatttaccaaacattcatcaccttaatcaggtagtattaatctcaaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46303304 |
tcagctatgttgttgaaggaagacttcattgccattaatgcttgtcctaatgcatttaccaaacattcatcaccttaatcaggtagtattaatctcaaac |
46303205 |
T |
 |
| Q |
211 |
ataggatcttttaatatcattattatagcacatattgtgtat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46303204 |
ataggatcttttaatatcattattatagcacatattgtgtat |
46303163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University