View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5744-Insertion-7 (Length: 258)
Name: NF5744-Insertion-7
Description: NF5744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5744-Insertion-7 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 6 - 258
Target Start/End: Original strand, 2686066 - 2686318
Alignment:
| Q |
6 |
catggatggtaacaaagtatctgttggataatcaaagctttgccatagatattttgtcggatcattcacgtttgtttctcttagaactaaatttccatta |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2686066 |
catggatggtaacaaagtatctgttggataatcaaagctttgccatagatattttgtcggatcattcacgtttgtttctcttagaactaaatttccatta |
2686165 |
T |
|
| Q |
106 |
tcgaaaagctgtagaacaagtgggttggtagcttttgtttgattcgaagaccatatgaggttgttgtctgaatctgatgatgaattgagaagtactatgt |
205 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2686166 |
tcgaaaagctgaagaacaagtgggttggtagcttttgtttgattggaagaccatatgaggttgttgtctgaatctgatgatgaattgagaagtactatgt |
2686265 |
T |
|
| Q |
206 |
ttccattgtcaccgattttgaggtgactattggttgaattttgaagagggttg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2686266 |
ttccattgtcaccgattttgaggtgactattggttgaattttgaagagggttg |
2686318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 52
Target Start/End: Complemental strand, 2669967 - 2669927
Alignment:
| Q |
12 |
tggtaacaaagtatctgttggataatcaaagctttgccata |
52 |
Q |
| |
|
||||||||||||||||||||||| |||||| || ||||||| |
|
|
| T |
2669967 |
tggtaacaaagtatctgttggatgatcaaaactctgccata |
2669927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 13 - 71
Target Start/End: Complemental strand, 36361000 - 36360942
Alignment:
| Q |
13 |
ggtaacaaagtatctgttggataatcaaagctttgccatagatattttgtcggatcatt |
71 |
Q |
| |
|
||||||||||||||||| || |||||||| |||||||||||| | ||||| |||||||| |
|
|
| T |
36361000 |
ggtaacaaagtatctgtagggtaatcaaaactttgccatagaaaatttgttggatcatt |
36360942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University