View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5744-Insertion-9 (Length: 147)
Name: NF5744-Insertion-9
Description: NF5744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5744-Insertion-9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 2e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 27 - 147
Target Start/End: Original strand, 35104599 - 35104719
Alignment:
| Q |
27 |
ccctaaatcctttcactttgttcaattcttcttcaatatgagcatgacccaatttgctatggtatgtgttctcaattctattcctttctatcaatttgct |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35104599 |
ccctaaatcctttcactttgttcaattcttcttcaatatgagcatgacccaatttgctatggtatgtgttctcaattctattcctttctatcaatttgct |
35104698 |
T |
 |
| Q |
127 |
ctcacgaatttcaattttgct |
147 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
35104699 |
ctcacgaatttcaattttgct |
35104719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University