View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5744_high_19 (Length: 250)
Name: NF5744_high_19
Description: NF5744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5744_high_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 122 - 243
Target Start/End: Complemental strand, 37430219 - 37430098
Alignment:
| Q |
122 |
tatgttttaagtaagtgggtgatttgaatgatcatatattatggtagtggatgaaacaaaatcctgctgaagggctccctatatccggtcgtataactgc |
221 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37430219 |
tatgttttaagtaagtggttgatttgaatgatcatatattatggtagtggatgaaacaaaatcccgctgaagggctccctatatccggtcgtataactgc |
37430120 |
T |
|
| Q |
222 |
aactgagccgtttcttcatctc |
243 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
37430119 |
aaccgagccgtttcttcatctc |
37430098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University