View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5744_low_11 (Length: 390)
Name: NF5744_low_11
Description: NF5744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5744_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 152 - 372
Target Start/End: Original strand, 35804945 - 35805168
Alignment:
| Q |
152 |
gttggtggtacggtgagttttctcttcacgtgggaaaaaagtttttctattgcattaaaatggaattcctctaaaacaaaca---ttgtgcaagattctc |
248 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35804945 |
gttgatggtacggtgagttttctcttcacgtgggaaaaaagtttttctattgcattaaaatggaattcctctaaaacaaacaacattgtgcaagattctc |
35805044 |
T |
|
| Q |
249 |
gttcttctttttcatgatattatttattcttgagaataaatttctcttccataaaacaaacatttcctactctttctgtttaaacagaaacataaggatt |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35805045 |
gttcttctttttcatgatattatttattcttgagaataaatttctcttccataaaacaaacattccctactctttctgtttaaacagaaacaaaaggatt |
35805144 |
T |
|
| Q |
349 |
aagattctcttctccctttttgtt |
372 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35805145 |
aagattctcttctccctttttgtt |
35805168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 20 - 70
Target Start/End: Original strand, 35804815 - 35804865
Alignment:
| Q |
20 |
gaattctcggaaatatctttagcatccatgaaacaaacacatatattgtag |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35804815 |
gaattctcggaaatatctttagcatccatgaaacaaacacatatattgtag |
35804865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University