View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5744_low_12 (Length: 371)
Name: NF5744_low_12
Description: NF5744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5744_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 198 - 361
Target Start/End: Original strand, 25075799 - 25075962
Alignment:
| Q |
198 |
gggctaaaggtgggtttgctttatttatagaaaggacttgatatatttgacatcattttttcttagaatgatgatcttaccaactagtttgagactgttg |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25075799 |
gggctaaaggtgggtttgctttatttatagaaaggacttgatatactttacatcattttttctttgaatgatgatcttaccaactagtttgagactgttg |
25075898 |
T |
|
| Q |
298 |
atttgtcttacgtgttgtgatgtcatatgagttgaaaacttgtgatttttggatttagcctatg |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25075899 |
atttgtcttacgtgttgtgatgtcatatgagttgaaaacttgtgatttttggatttagcctatg |
25075962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 18 - 133
Target Start/End: Original strand, 25075621 - 25075736
Alignment:
| Q |
18 |
ggaatctagaagaaatatcctaagatcaaaacacaaaaggacagtatatgaaatcaaataagttaatcttttaccttaaagttggcaactcagagaagca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25075621 |
ggaatctagaagaaatatcctaagatcaaaacacaaaaggacagtatatgaaatcaaataagttaatcttttaccttaaagttggcaactcagagaagca |
25075720 |
T |
|
| Q |
118 |
gtatccagctaactag |
133 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
25075721 |
gtatccagctaactag |
25075736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University