View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5744_low_21 (Length: 250)

Name: NF5744_low_21
Description: NF5744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5744_low_21
NF5744_low_21
[»] chr7 (1 HSPs)
chr7 (122-243)||(37430098-37430219)


Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 122 - 243
Target Start/End: Complemental strand, 37430219 - 37430098
Alignment:
122 tatgttttaagtaagtgggtgatttgaatgatcatatattatggtagtggatgaaacaaaatcctgctgaagggctccctatatccggtcgtataactgc 221  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
37430219 tatgttttaagtaagtggttgatttgaatgatcatatattatggtagtggatgaaacaaaatcccgctgaagggctccctatatccggtcgtataactgc 37430120  T
222 aactgagccgtttcttcatctc 243  Q
    ||| ||||||||||||||||||    
37430119 aaccgagccgtttcttcatctc 37430098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University