View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5744_low_26 (Length: 225)
Name: NF5744_low_26
Description: NF5744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5744_low_26 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 25 - 225
Target Start/End: Original strand, 44695339 - 44695539
Alignment:
| Q |
25 |
gatagtttctgaaaactctgcatgtatgtgaagtcattgaatggtattttgttatggagtaatcttcatcgtaatttacgttcaattccacccttgattt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44695339 |
gatagtttctgaaaactctgcatgtatgtgaagtcattgaatggtattttgttatggagtaatcttcattgtaatttacgttcaattccacccttgattt |
44695438 |
T |
 |
| Q |
125 |
aaataatcgatatgatttagtatttaaatgattcaaacttgactaaaagatagaaaatggaatgatgggagaaagtttgaaaaatttgaggactaaatca |
224 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44695439 |
aaataattgatatgatttagtatttaaatgattcaaacttgactaaaagatagaaaaaggaatgatgggagaaagtttgaaaaatttgaggactaaatca |
44695538 |
T |
 |
| Q |
225 |
t |
225 |
Q |
| |
|
| |
|
|
| T |
44695539 |
t |
44695539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University