View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5745-Insertion-5 (Length: 260)
Name: NF5745-Insertion-5
Description: NF5745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5745-Insertion-5 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 7 - 260
Target Start/End: Complemental strand, 8441479 - 8441225
Alignment:
| Q |
7 |
aaatataaggtttggttaggtcc-tatggtgttggaatcagcttttcaaccatttcatgctttggttgtcttttaacttgttgatcaaattatcatcatt |
105 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8441479 |
aaatataaggtttggttaggtccctatggtgttggaatcaacttttcaaccatttcatgctttggttgtcttttaacttgttgatcaaattgacatcatt |
8441380 |
T |
|
| Q |
106 |
gagatcacttgtaattgtggtgaaaacgcgactgcagtaagatagaataaaaaagctgttggttagagattgtgtgtgcagtaagataaataaaacagtg |
205 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8441379 |
gagatcacttgtagttgtggtcaaaacgcgactgcagtaagataaaataaaaaagctgttggttagagattgtgtgtgcagtaagataaataaaaaggtg |
8441280 |
T |
|
| Q |
206 |
ttggttagagattgtgtgtgcccctctacgggctgatccaagcataaaactgtgt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8441279 |
ttggttagagattgtgtgtgcccctctacgggctgatccaagcataaaactgtgt |
8441225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 11 - 74
Target Start/End: Complemental strand, 8443242 - 8443177
Alignment:
| Q |
11 |
ataaggtttggttaggtcc-tatggtgttggaatcagctttt-caaccatttcatgctttggttgt |
74 |
Q |
| |
|
||||||||||| ||||||| |||| ||||| ||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
8443242 |
ataaggtttggctaggtccctatgatgttgaaatcagcttttgcaaccctttcatgctttggttgt |
8443177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University