View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5745_low_10 (Length: 427)
Name: NF5745_low_10
Description: NF5745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5745_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 384; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 384; E-Value: 0
Query Start/End: Original strand, 1 - 413
Target Start/End: Complemental strand, 52385947 - 52385535
Alignment:
| Q |
1 |
catatgcctttcccgcttcatctttctcttcttcctctttggttcggtgtatgttgtggattgaccccttcttccttgttgattgggaatgggaacctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52385947 |
catatgcctttcccgcttcatctttctcttcttcctctttggttcggtgtatgttgtggattgaccccttcttccttgttgattgggaatgggaacctgc |
52385848 |
T |
|
| Q |
101 |
cacatgcattgttgctcctctgttgtcgcccgccagagttaccacactgactgttttgtcatctgtcggaagctgtgttgctgttgatgtgctcaccgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52385847 |
cacatgcattgttgctcctctgttgtcgcccgccagagttaccacactgactgttttgtcatctgtcggaagctgtgttgctgttgatgtgctcaccttg |
52385748 |
T |
|
| Q |
201 |
gctactttattagtaagatttgttacatcatccttcatagtactattttgcatggtaactggatctgcaactaattggatgnnnnnnncactagggtttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
52385747 |
gctactttattagtaagatttgttacatcatccttcatagtactattttgcatggtaattggatctgcaactaattggatgtttttttcactagggtttg |
52385648 |
T |
|
| Q |
301 |
atgtggcaatggcaaacatcatgtttctctctagagttgtttgaggttcagaaattgaggtaggaggaggctgtggtggggaataggccaattgtgaagg |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52385647 |
atgtggcaatggcaaacatcatgtttctctctagagttgtttgaggttcagaaattgaggtaggaggaggctgtggtggggaataggccaattgtgaagg |
52385548 |
T |
|
| Q |
401 |
aaattttgatctt |
413 |
Q |
| |
|
||||||||||||| |
|
|
| T |
52385547 |
aaattttgatctt |
52385535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University