View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5745_low_18 (Length: 295)
Name: NF5745_low_18
Description: NF5745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5745_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 1e-47; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 52242332 - 52242228
Alignment:
| Q |
1 |
catgaaataattgggacaggtttacacggttaatgttctgctcttataatcaataaccaaataattttggtgcaggaaatcttaatacttagagaagagg |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52242332 |
catgaaataattgggaccggtttacacggttaatgttctgctcttataatcaataaccaaataattttggtccaggaaatcttaatacttagagaagagg |
52242233 |
T |
 |
| Q |
101 |
cattg |
105 |
Q |
| |
|
||||| |
|
|
| T |
52242232 |
cattg |
52242228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 141 - 196
Target Start/End: Complemental strand, 52242192 - 52242137
Alignment:
| Q |
141 |
aaaacataaattgtacggtatccgtttttctgtatggtatctgtttattctagtaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52242192 |
aaaacataaattgtacggtatccgtttttctgtacggtatctgtttattctagtaa |
52242137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 243 - 290
Target Start/End: Complemental strand, 52242089 - 52242042
Alignment:
| Q |
243 |
acacttcataaattcaacctttgacaggattgtaatgtctgtgctgct |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
52242089 |
acacttcataaattcaacctttgacaggattgtaatgtttgtgatgct |
52242042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University