View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5745_low_23 (Length: 241)
Name: NF5745_low_23
Description: NF5745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5745_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 52242334 - 52242550
Alignment:
| Q |
1 |
cgtgtaacaataaacaccctattcatggattcagatcgtacccttacaaatgcattcaatcttctttcttcccagccatctcctcctatcctgtgagctt |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52242334 |
cgtgtaacaataa-caccctattcatggattcagatcgtacccttacaaatgcattcaatcttctttcttcccagccatctcctcctatcctgtgagctt |
52242432 |
T |
|
| Q |
101 |
agccgtaccatattgttatttttggtaagtgataatttaataattgttttagatttagtgcttagcatttatctatatgaaatgataggataagtgtaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52242433 |
agccgtaccatattgttatttttggtaagtg---atttaattattgttttagatttagtgcttagcatttatctatatgaaatgataggataagtgtaat |
52242529 |
T |
|
| Q |
201 |
cttaaaataaaggtttataaa |
221 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
52242530 |
cttaaaataaaggtctataaa |
52242550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University