View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5745_low_25 (Length: 216)
Name: NF5745_low_25
Description: NF5745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5745_low_25 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 51362032 - 51362247
Alignment:
| Q |
1 |
attgatttatcgtaaaatgcaatgttattgtatttaccggctgattccaaatttactaatcctacgaccggcggagaaagaaaaacatttgtattgttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51362032 |
attgatttatcgtaaaatgcaatgttattgtatttaccggctgattccaaatttactaatcctacgaccggcggagaaagaaaaacatttgtattgttga |
51362131 |
T |
 |
| Q |
101 |
aaaataaaattgatcaagactcttttttgtcaaaagcaggtgaacactcttgttagtattacattatttttcatacttaattattttaagtgtagggaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51362132 |
aaaataaaattgatcaagactcttttttgtcaaaagcaggtgaacactcttgttagtattacattatttttcatactaaattattttaagtgtagggaaa |
51362231 |
T |
 |
| Q |
201 |
atcatatgaattattt |
216 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
51362232 |
attatatgaattattt |
51362247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University