View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746-Insertion-3 (Length: 501)
Name: NF5746-Insertion-3
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746-Insertion-3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 8 - 345
Target Start/End: Complemental strand, 43062539 - 43062191
Alignment:
| Q |
8 |
agttaattgagttatgttgccccctatcgtcgttgatctcaacgacattaaacaaaaactctcccttcagtttcgtcctattcaacgttcctttcagttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062539 |
agttaattgagttatgttgccccctatcgtcgttgatctcaacgacattaaacaaaaactctcccttcagtttcgtcctattcaacgttcctttcagttt |
43062440 |
T |
|
| Q |
108 |
tgggttcgagccgttgatatttacaccggatacaaggttcctttcactct------------aaccaaattgctacgttaattaattaactatgcatgct |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43062439 |
tgggttcgagccgttgatatttacaccggatacaaggttcctttctctctctctctctctctaaccaaattgctacattaattaattaactatgcatgct |
43062340 |
T |
|
| Q |
196 |
tcatttttctcgaattgcaggtttttcaattgagagtcaatttcgtgaaagatgcacagaagcaagaagcaatgtgggaaagacagcatgagcttgctgc |
295 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062339 |
tcatttt-ctcgaattgcaggtttttcaattgagagtcaatttcgtgaaagatgcacagaagcaagaagcaatgtgggaaagacagcatgagcttgctgc |
43062241 |
T |
|
| Q |
296 |
cgataagattttctctatgtgctctgaccttggtggtttcttcctcaagg |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062240 |
cgataagattttctctatgtgctctgaccttggtggtttcttcctcaagg |
43062191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 410 - 501
Target Start/End: Complemental strand, 43062126 - 43062035
Alignment:
| Q |
410 |
aactagttttgttgatttttgtattcagattgcacaaattattgggaagccggatttggcaccggctgcatgggtgaaaaggctggttacgc |
501 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43062126 |
aactagttttgttgatttttgtattcagattgcacaaattattgggaagccggatttggcaccggctgcatgggtgaaaaggctggttacgc |
43062035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University