View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746-Insertion-9 (Length: 86)
Name: NF5746-Insertion-9
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746-Insertion-9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 63; Significance: 5e-28; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 5e-28
Query Start/End: Original strand, 7 - 77
Target Start/End: Original strand, 21542776 - 21542846
Alignment:
| Q |
7 |
agtctcaacttgagctcctttaagctgatgtccctgaacaaatagcataaaataaacaccagttccataaa |
77 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21542776 |
agtctctacttgagctcctttaagctgatttccctgaacaaatagcataaaataaacaccagttccataaa |
21542846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University