View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_high_107 (Length: 220)
Name: NF5746_high_107
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_high_107 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 22 - 205
Target Start/End: Original strand, 43597438 - 43597622
Alignment:
| Q |
22 |
gagcataggtctcaaattagtatcactaaaacaactcaaatgaattaaatcaaagata-tatatataaattttgttttagggaaaatcaaaggtagagtt |
120 |
Q |
| |
|
||||||||||||||||| | | |||||||| |||||||||||||||||||||||||| | | | | |||| |||||||||||||||||||||||||| |
|
|
| T |
43597438 |
gagcataggtctcaaatcaacaccactaaaataactcaaatgaattaaatcaaagatagtttttttttttttttttttagggaaaatcaaaggtagagtt |
43597537 |
T |
 |
| Q |
121 |
gaatgttgatttattatgatattggaccgactgaataaatacgtgaccatgttgtcttttatgacccaaagacataatgtctctg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43597538 |
gaatgttgatttattatgatattggaccatctgaataaatacgtgaccatgttgtcttttatgacccaaagacataatgtctctg |
43597622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University