View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_high_112 (Length: 208)
Name: NF5746_high_112
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_high_112 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 28 - 192
Target Start/End: Original strand, 26284039 - 26284210
Alignment:
| Q |
28 |
aaaataagatgtttgatgaccgtaaaaataaataaattaag-cgtctaaatctcttgactttctagct------gacaagtttttatactctttaacttc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26284039 |
aaaataagatgtttgatgaccgtaaaaataaataaattaagacgtctaaatctcttgactttctagctatgattgacaagtttttatactctttaacttc |
26284138 |
T |
|
| Q |
121 |
ttattatattcttgtatttcatggattaaattggagagaatgatgttttagaaaataaattgatgatttatt |
192 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26284139 |
ttattatattcttgtattttatggattaaattggagagaatgatgttttagaaaataaattgatgatttatt |
26284210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University