View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_high_56 (Length: 312)
Name: NF5746_high_56
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_high_56 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 280; Significance: 1e-157; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 19 - 298
Target Start/End: Original strand, 1430897 - 1431176
Alignment:
| Q |
19 |
cgatcagctgcttcttcaaacgatgcaggcaaaccatttcccttatgaatatcaagagccatttgacacagcttcttcgcttcatcaaattgtagggctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1430897 |
cgatcagctgcttcttcaaacgatgcaggcaaaccatttcccttatgaatatcaagagccatttgacacagcttcttcgcttcatcaaattgtagggctt |
1430996 |
T |
|
| Q |
119 |
gaacatgtgcttcggctacataccgacatgtctcaccgaatcgaggatcggtttcccctaggacctgcccttgaatttcaagacctgctgtataaaacag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1430997 |
gaacatgtgcttcggctacataccgacatgtctcaccgaatcgaggatcggtttcccctaggacctgcccttgaatttcaagacctgctgtataaaacag |
1431096 |
T |
|
| Q |
219 |
tagagaattctcaatatttcccatcattgcataagtatcacctaattgcatacaccctgcaaacttagctagtgcatgat |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1431097 |
tagagaattctcaatatttcccatcattgcataagtatcacctaattgcatacaccctgcaaacttagctagtgcatgat |
1431176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 298
Target Start/End: Complemental strand, 1250714 - 1250640
Alignment:
| Q |
224 |
aattctcaatatttcccatcattgcataagtatcacctaattgcatacaccctgcaaacttagctagtgcatgat |
298 |
Q |
| |
|
||||||| |||||||||||||||| |||||| ||| ||||| || |||| ||||||||||||| ||||||||| |
|
|
| T |
1250714 |
aattctcgatatttcccatcattgtataagtgtcatgtaatttcacgcaccatgcaaacttagcttgtgcatgat |
1250640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 115 - 200
Target Start/End: Complemental strand, 1250810 - 1250725
Alignment:
| Q |
115 |
gcttgaacatgtgcttcggctacataccgacatgtctcaccgaatcgaggatcggtttcccctaggacctgcccttgaatttcaag |
200 |
Q |
| |
|
|||||||||||||| || ||||| | | ||||||||||||||||| |||||| |||||||| | | |||| ||| |||||||||| |
|
|
| T |
1250810 |
gcttgaacatgtgcctcagctacgtgcatacatgtctcaccgaatctaggatcagtttcccccaagtcctgacctggaatttcaag |
1250725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 62 - 110
Target Start/End: Original strand, 43926838 - 43926886
Alignment:
| Q |
62 |
tatgaatatcaagagccatttgacacagcttcttcgcttcatcaaattg |
110 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||| || ||||||||||| |
|
|
| T |
43926838 |
tatgaatatcaagagcaatttgacacagcctctcagcctcatcaaattg |
43926886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University