View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_high_59 (Length: 301)
Name: NF5746_high_59
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_high_59 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 19 - 300
Target Start/End: Original strand, 9378601 - 9378882
Alignment:
| Q |
19 |
tggaggtataagcactctaacaggaacaggtgtgaacttgataataattggaatgtggaaaagccttgcccctgaagcaaaaccaataagcttcaattct |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9378601 |
tggagggataagcactctaacaggaacaggtgtgaacttgataataattggaatgtggaaaagccttgcccctgaagcaaaaccaataagcttcaattct |
9378700 |
T |
 |
| Q |
119 |
tggtttttctttgggttccctgtggctgttttgttgcttctctgcttttggtgtatactatgtttgatttatgttcgaaaggggtcgagtagggctttgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9378701 |
tggtttttctttgggttccctgtggctgttttgttgcttctctgcttttggtgtatactatgtttgatttatgttcgaaaggggtcgagtagggctttgt |
9378800 |
T |
 |
| Q |
219 |
ctgattatttggatagagctctcttgaagagagaccttgaagctcttggtaagtttctcacttctaacctatttgaatatat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9378801 |
ctgattatttggatagagctctcttgaagagagaccttgaagctcttggtaagtttctcacttctaacctatttgaatatat |
9378882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 131
Target Start/End: Original strand, 55737131 - 55737243
Alignment:
| Q |
19 |
tggaggtataagcactctaacaggaacaggtgtgaacttgataataattggaatgtggaaaagccttgcccctgaagcaaaaccaataagcttcaattct |
118 |
Q |
| |
|
|||||| || |||||| | ||||| |||||||| || |||||| | |||||||||||||| || |||| |||| |||||||||||||| ||||| | |
|
|
| T |
55737131 |
tggaggaatgagcactttgacagggacaggtgtaaatttgatattgattggaatgtggaagagtcttgttcctggtgcaaaaccaataagtttcaacaca |
55737230 |
T |
 |
| Q |
119 |
tggtttttctttg |
131 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
55737231 |
tggttcttctttg |
55737243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University