View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_high_61 (Length: 292)
Name: NF5746_high_61
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_high_61 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 142 - 285
Target Start/End: Complemental strand, 11088791 - 11088644
Alignment:
| Q |
142 |
tcttagttacgtgatggaaccattcatgtctacagaggaactgaatgtgaatcaatagaacaaggagttgataaatgtggtccatgactatagactttg- |
240 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
11088791 |
tcttatttacgtgatggaaccattcatgtctatagaggaactgaatgtgaatcaatagaacaaagagttgataaacgtggtccatgactatagagtttgg |
11088692 |
T |
 |
| Q |
241 |
---gaaacaacttcaaaaaatcattcagatcagtttcatttgatgatg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11088691 |
aaagaaacaacttcaaaaaatcattcagatcagtgtcatttgatgatg |
11088644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 11088835 - 11088784
Alignment:
| Q |
19 |
ttatcgtgtgctgattttttgaatgcccatatcggtcataatccttcttattt |
71 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
11088835 |
ttatcgtgtgctgatttttt-aatgcccatatcggtcataatctttcttattt |
11088784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 33 - 99
Target Start/End: Complemental strand, 2160375 - 2160310
Alignment:
| Q |
33 |
ttttttgaatgcccatatcggtcataatccttcttattttttggtgaagtttatggtctacacgagc |
99 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||| || ||||||||| |||||||| ||| |||| |
|
|
| T |
2160375 |
ttttttgaatgctcatattggtcataatccttctta-ttcttggtgaagcttatggtccacaagagc |
2160310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University