View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_high_62 (Length: 292)
Name: NF5746_high_62
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_high_62 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 8 - 110
Target Start/End: Original strand, 25771591 - 25771693
Alignment:
| Q |
8 |
gagcagagaacacggtatttgcattgcaaaacttgaatttaagattgtaaactggcctcaatcacataaatgtgtcttctcaattccaatagaaaactca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25771591 |
gagcagagaacacggtatttgcattgcaaaacttgaatttaagattgtaaactggcctcaatcacatgaatgtgtcttctcaattccaatagaaaactca |
25771690 |
T |
 |
| Q |
108 |
att |
110 |
Q |
| |
|
||| |
|
|
| T |
25771691 |
att |
25771693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 154 - 274
Target Start/End: Original strand, 25745062 - 25745182
Alignment:
| Q |
154 |
attagaaaatgtaatttctctgtttcgccaacatcaccttcagatgatatgatctaacgtcccgaatttgattagtctaatgcacatatgacctcagatt |
253 |
Q |
| |
|
|||||||||| |||||| ||||||||||| |||||| ||||||||| |||||||||| ||| |||||||||||| |||| || ||| | |||||||| |
|
|
| T |
25745062 |
attagaaaatctaatttatctgtttcgcctacatcatcttcagatgctatgatctaatgtctataatttgattagtttaattcatgtataaactcagatt |
25745161 |
T |
 |
| Q |
254 |
ttaaacacactctattataca |
274 |
Q |
| |
|
||||| ||| || ||||||| |
|
|
| T |
25745162 |
ataaactcaccctgttataca |
25745182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 9 - 51
Target Start/End: Complemental strand, 45301995 - 45301953
Alignment:
| Q |
9 |
agcagagaacacggtatttgcattgcaaaacttgaatttaaga |
51 |
Q |
| |
|
||||||| ||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
45301995 |
agcagaggacaaggtatgtgcattgcaaaacttgaatttaaga |
45301953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University