View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_high_82 (Length: 258)
Name: NF5746_high_82
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_high_82 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 99 - 248
Target Start/End: Original strand, 5497993 - 5498143
Alignment:
| Q |
99 |
tgtatagtttcggttgcatattaaatattgaactttactagtactacacattgtataggctggtgaatgagctgtttagtataaacttgatcagaaaatg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5497993 |
tgtatagtttcggttgcatattaaatattgaactttactagtactacacattgtataggctggtgaatgagctgtttagtataaacttgatcagaaaatg |
5498092 |
T |
|
| Q |
199 |
cattgtcaaatccaacggctggagacacttgac-ctaaccgctgcattcat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5498093 |
cattgtcaaatccaacggctggagacacttgactctaaccgctgcattcat |
5498143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University