View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_high_92 (Length: 240)
Name: NF5746_high_92
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_high_92 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 79 - 161
Target Start/End: Complemental strand, 43289445 - 43289365
Alignment:
| Q |
79 |
aagaggaatgattggtgaagttccgattctggttatcgcgttgctttcattcattgcttgctttattattctcagtcactgag |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43289445 |
aagaggaatgattggtgaagttccgattctggttatcgcgttgctttcattcattgcttgctttattat--tcagtcactgag |
43289365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 221
Target Start/End: Complemental strand, 43289361 - 43289316
Alignment:
| Q |
178 |
ggaaggagcgagaagtaacata--acattacttcctcatctctttt |
221 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
43289361 |
ggaaggagcgagcagtaacatataacattacttcctcatctctttt |
43289316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University