View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_low_106 (Length: 227)
Name: NF5746_low_106
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_low_106 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 49274208 - 49274417
Alignment:
| Q |
1 |
atatgtataaaataaaaagaattaatttcattatgatttgatgtaaataatgagtaaacaatctattggtcccttaatgtgagaggtggtgtcattatgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49274208 |
atatgtataaaataaaaagaattaatttcattatgatttgatgcaaataatgagtaaacaacctattggtcccttaatgtgagagatggtgtcattatga |
49274307 |
T |
 |
| Q |
101 |
tccttaaatgtattgaaacttcaaaacatctatgaatgtgttttctgtttgtaatcttgtggagaactgataaacatagtacacattcatgattaaacta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49274308 |
tccttaaatgtattgaaacttcaaaacatctgcgaatgtgttttctgtttgtaatcttgtggagaactgataaacatagtacacattcatgattaaacta |
49274407 |
T |
 |
| Q |
201 |
actagcaaaa |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
49274408 |
actagcaaaa |
49274417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University