View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_low_119 (Length: 202)
Name: NF5746_low_119
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_low_119 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 184
Target Start/End: Original strand, 293401 - 293567
Alignment:
| Q |
18 |
gaacgcagcaattggcgccggtgggggacttggtgtttcttctgggagtacatagagttctggggggcaatagtcaggatccaaaagggtgcggtcggga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
293401 |
gaacgcagcaattggcgccggtgggggacttggtgtttcttctgggagtacatagagttctggggggcaatagtcaggatccaaaagggtgcggtcggga |
293500 |
T |
 |
| Q |
118 |
acataattctttccgatccgaaggtctgttgcagcaccaaaatcaatgagtttaatctgcccctgtt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
293501 |
acataattctttccgatccgaaggtctgttgcagcaccaaaatcaatgagtttaatctgcccctgtt |
293567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 118 - 179
Target Start/End: Complemental strand, 27492546 - 27492485
Alignment:
| Q |
118 |
acataattctttccgatccgaaggtctgttgcagcaccaaaatcaatgagtttaatctgccc |
179 |
Q |
| |
|
|||||||||||||| || | |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27492546 |
acataattctttccaattctaaggtctgttgctgcaccaaaatcaatgagtttaatctgccc |
27492485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University