View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_low_38 (Length: 377)
Name: NF5746_low_38
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 2e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 15 - 216
Target Start/End: Complemental strand, 41398330 - 41398129
Alignment:
| Q |
15 |
gagaatgagaggtgtttaatgtggtatgaaaattatccatggcatgtgaagattagagatggatggaaggaattcgctgcagcaagcaagtttgtgaaag |
114 |
Q |
| |
|
||||| |||||||||||||| ||||||||| |||||||||||||||||||||||| ||||||||| ||||| || |||||| |||||||||| ||||||| |
|
|
| T |
41398330 |
gagaacgagaggtgtttaatttggtatgaagattatccatggcatgtgaagattaaagatggatgaaaggagtttgctgcaacaagcaagttggtgaaag |
41398231 |
T |
 |
| Q |
115 |
gagaccggatcatcttcaacattgttaatattaattttaacaatgagattaaggtgatgaaagaaagttatttatttgaagaggatgctggtgccttttt |
214 |
Q |
| |
|
|||| | ||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||| || || ||||||||||| |||||||||||| |
|
|
| T |
41398230 |
gagaacagatcatcttcaacattgttaacatcaattataacaatgagattaaggtgatgaaagaaagctacacatatgaagaggatgatggtgccttttt |
41398131 |
T |
 |
| Q |
215 |
gg |
216 |
Q |
| |
|
|| |
|
|
| T |
41398130 |
gg |
41398129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 261 - 374
Target Start/End: Original strand, 36743665 - 36743778
Alignment:
| Q |
261 |
atcagaaagggaatccgttgctgaaacatattaggaatgtgagatggacatttgccgatgttgtttgtgatttcttgcttggacaaagctcatgtgctct |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36743665 |
atcagaaagggaatccgttgctgaaacatattaggaacgtgagatggacatttgccgatgttgtttgtgatttcttgcttggacaaagctcatgtgctct |
36743764 |
T |
 |
| Q |
361 |
ctatctcaggttat |
374 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36743765 |
ctatctcaggttat |
36743778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University