View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_low_48 (Length: 334)
Name: NF5746_low_48
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_low_48 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 24 - 315
Target Start/End: Complemental strand, 7475014 - 7474723
Alignment:
| Q |
24 |
tgacaacatggcagccccgccgcaaggtctccctcttcagacggcggaaggttcaaacggtgaggctaggcagcaagaaaccacgacggagaataattgg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7475014 |
tgacaacatggcagccccgccgcaaggtctccctcttcagacggcggaaggttcaaacggtgaggctaggcagcaagaaaccacgacggagaataattgg |
7474915 |
T |
|
| Q |
124 |
tggcatagttagaatgtttaaaaggatgcgtgtaaagtggcttaagttacaatatcttaggttattaaaacggcttaaggaacattatagaaacgttgtg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7474914 |
tggcatagttagaatgtttaaaaggatgcgtgtaaagtggcttaagttacaatatcttaggttgttaaaacggcttaaggaacattatagaaacgttgtg |
7474815 |
T |
|
| Q |
224 |
aaagatcttattgaagctggtgctaccattgaaacttttcaacaacgcctttttatggaaagcacttttgctgtccctcttggtgttaactt |
315 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7474814 |
aaagatctcattgaagctggtgctaccattgaaacttttcaacaacgcctttttatggaaagcacttttgctgtccctcttggtgttaactt |
7474723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University