View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_low_5 (Length: 626)
Name: NF5746_low_5
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-141; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-141
Query Start/End: Original strand, 47 - 387
Target Start/End: Complemental strand, 4305522 - 4305187
Alignment:
| Q |
47 |
aaactgctagcggtgttgggaggtccacatccattgttagtggttacatcattcattgaattgaattgaattgaataatgacttgttttgctttttggta |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4305522 |
aaactgctagcggtgttgggaggtccacatccattgttagtggttgcatcattcattgaattgaat----------aatgacttgttttgctttttggta |
4305433 |
T |
|
| Q |
147 |
gtcccat-----atcagcacgttttatttattttatttgcctagatcactttcgaaaaagataaaggttatcccttctttccttttcatctcaaaatatc |
241 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4305432 |
gtcccatcccatatcagcacgttttatttattttatttgcctagatcactttcgaaaaagataaaggttatcccttctttccttttcatctcaaaatatc |
4305333 |
T |
|
| Q |
242 |
tcttggggaacttataaaataagtttcaaaataaaattgatgttaatggttcggtcgaggtatcttttaataattctcaattgtgattgtctttgtgatt |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| ||| |||||||||||| | ||||||||||||||| ||||| ||||||||||| |
|
|
| T |
4305332 |
tcttggggaacttataaaataagtttcaaaataaaattgatgctaattgtttggtcgaggtatcatctaataattctcaattttgattttctttgtgatt |
4305233 |
T |
|
| Q |
342 |
taaatgattacgttgaggaagatattatgttttaaaaccgtgaatt |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4305232 |
taaatgattacgttgaggaagatattatgttttaaaaccatgaatt |
4305187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 115 - 285
Target Start/End: Complemental strand, 4310779 - 4310596
Alignment:
| Q |
115 |
aattgaataatgacttgttttgctttttgg-tagtcccatatcagcacgttttatttattttatttgcctagatc-------------actttcgaaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| | ||| |
|
|
| T |
4310779 |
aattgaataatgacttgttttggtttttgggtagtcccatatcagcacgttttatttattttatttgcctagatcaaatgatcaagttacttgggcaaag |
4310680 |
T |
|
| Q |
201 |
gataaaggttatcccttctttccttttcatctcaaaatatctcttggggaacttataaaataagtttcaaaataaaattgatgtt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||| |||| ||||| |||||||| |
|
|
| T |
4310679 |
ctaaaaggttatcccttctttccttttcatctcaaaatgtctcttggggaactcataaaat-agtctcaacataaagttgatgtt |
4310596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University