View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_low_51 (Length: 323)
Name: NF5746_low_51
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_low_51 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 181 - 306
Target Start/End: Complemental strand, 38051380 - 38051255
Alignment:
| Q |
181 |
ggcatgcacaaaatgaatcataagctagtcgagtgcaccataaaatctgttgcaaagaatcccaagtccagtcatgcatgagcttggaggggaaatttac |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38051380 |
ggcatgcacaaaatgaatcataagctagtcgagtgcaccataaaatctgttgcaaagaatcccaagtccagtcatgcatgagcttggaggggaaatttac |
38051281 |
T |
 |
| Q |
281 |
atgcatacatttgcatgagctaggtg |
306 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
38051280 |
atgcatacatttgcatgagctaggtg |
38051255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 38051571 - 38051494
Alignment:
| Q |
1 |
gtatgcattaccaaaagctggtaagtgttgcaatatgtacggtggaatgcatgaggaaatgctaccacgtgtctctctc |
79 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38051571 |
gtatgcattaccaaa-gctggtaagtgttgcaatatgtacggtggaatgcatgaggaaatgctaccacgtgtctctctc |
38051494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University