View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_low_74 (Length: 273)
Name: NF5746_low_74
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_low_74 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 111 - 268
Target Start/End: Complemental strand, 33724219 - 33724063
Alignment:
| Q |
111 |
attaacatgacattatcattatattaacttgaacaagaagaaattaaagataattatgatgatcgatggttgcatacataaaatttaaatcgtgtgtgtg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33724219 |
attaacatgacattatcattatattaacttgaacaagaagaaattaaagataattatgatgatcgatggttgcatacataaaatttaaatcgtgtgtgtg |
33724120 |
T |
|
| Q |
211 |
gttacactgaatttatgttagataagtccccttgatttttgtatattttcatctcact |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
33724119 |
gttacactgaatttatgttagataagtccccttgattttt-tatattttcatatcact |
33724063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 17 - 110
Target Start/End: Complemental strand, 33724377 - 33724291
Alignment:
| Q |
17 |
cattttccatggattctcacataaagtttatccctcttgattagtattgactattgacacactacattgcttgcaatctcatacatttgtagat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33724377 |
cattttccatggattctcacataaagtttattcctcttgattagtat-------tgacacactacattgcttgcaatctcatacatttgtagat |
33724291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University