View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5746_low_77 (Length: 267)
Name: NF5746_low_77
Description: NF5746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5746_low_77 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 10 - 139
Target Start/End: Original strand, 30900961 - 30901088
Alignment:
| Q |
10 |
aagaatatggtttttaatagaagttttgtcagcaaataattaaaatctaacaaaataattattctattaggaattcaaattcaggttacatttttccctt |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30900961 |
aagaaaatggtttttaatagaagttttgtcaacaaataattaaaatctaacaaaataattattctattaggaattcaaattcaggttacatttttccctt |
30901060 |
T |
 |
| Q |
110 |
ttgcgtgtgtgtgtgttatatatattccac |
139 |
Q |
| |
|
|| |||||||||||||||||||||||||| |
|
|
| T |
30901061 |
tt--gtgtgtgtgtgttatatatattccac |
30901088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 164 - 267
Target Start/End: Original strand, 30901101 - 30901204
Alignment:
| Q |
164 |
ctcctttcatagaatatctagatagatcttaactatttcttaattgctcttctatacatttagttgttcttttaatataagatatacatataaataaatc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30901101 |
ctcctttcatagaatatctagatagatcttaactatttcttaattactcttctatacatttagttgttcttttaatataatttatacatataaataaatc |
30901200 |
T |
 |
| Q |
264 |
tcat |
267 |
Q |
| |
|
|||| |
|
|
| T |
30901201 |
tcat |
30901204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University